Article

Truncated SCRIB isoform promotes breast cancer metastasis through HNRNP A1 mediated exon 16 skipping

Bin Zhang1,2,3, Shao-han Xie1,2,3, Jun-yi Hu2,3, Si-jia Lei1,2, Liang-hua Shen1,2, Hong-tao Liu4, Qing Zheng1,2, Zhi-ming Zhang2, Chun-lian Wu5, Qiang Li6,7, Feng Wang1,2,3
1 Institute of Genomic Medicine, College of Pharmacy, Jinan University, Guangzhou 510632, China
2 State Key Laboratory of Bioactive Molecules and Druggability Assessment, Jinan University, Guangzhou 510632, China
3 International Cooperative Laboratory of Traditional Chinese Medicine Modernization and Innovative Drug Development of Chinese Ministry of Education (MOE), College of Pharmacy, Jinan University, Guangzhou 510632, China
4 College of Life Sciences, Zhengzhou University, No. 100 Kexue Avenue, Zhengzhou 450001, China
5 Key Laboratory of Southwest China Wildlife Resources Conservation (China West Normal University), Ministry of Education, Nanchong 637009, China
6 Department of General Surgery, The First Affiliated Hospital, Jinan University, Guangzhou 510630, China
7 Department of General Surgery, Chaoshan Hospital, The First Affiliated Hospital of Jinan University, Chaozhou City 515600, China
Correspondence to: Zhi-ming Zhang: zhangzm@jnu.edu.cn, Chun-lian Wu: wcl_xj@163.com, Qiang Li: liqiang@jnu.edu.cn, Feng Wang: jnubiopharm@126.com,
DOI: 10.1038/s41401-023-01116-4
Received: 30 December 2022
Accepted: 25 May 2023
Advance online: 4 July 2023

Abstract

Breast cancer is one of the most common malignant tumors with high mortality due to metastases. SCRIB, a scaffold protein mainly distributed in the cell membrane, is a potential tumor suppressor. Mislocalization and aberrant expression of SCRIB stimulate the EMT pathway and promote tumor cell metastasis. SCRIB has two isoforms (with or without exon 16) produced by alternative splicing. In this study we investigated the function of SCRIB isoforms in breast cancer metastasis and their regulatory mechanisms. We showed that in contrast to the full-length isoform (SCRIB-L), the truncated SCRIB isoform (SCRIB-S) was overexpressed in highly metastatic MDA-MB-231 cells that promoted breast cancer metastasis through activation of the ERK pathway. The affinity of SCRIB-S for the catalytic phosphatase subunit PPP1CA was lower than that of SCRIB-L and such difference might contribute to the different function of the two isoforms in cancer metastasis. By conducting CLIP, RIP and MS2-GFP-based experiments, we revealed that the heterogeneous nuclear ribonucleoprotein A1 (hnRNP A1) promoted SCRIB exon 16 skipping by binding to the “AG”-rich sequence “caggauggaggccccccgugccgag” on intron 15 of SCRIB. Transfection of MDA-MB-231 cells with a SCRIB antisense oligodeoxynucleotide (ASO-SCRIB) designed on the basis of this binding sequence, not only effectively inhibited the binding of hnRNP A1 to SCRIB pre-mRNA and suppressed the production of SCRIB-S, but also reversed the activation of the ERK pathway by hnRNP A1 and inhibited the metastasis of breast cancer. This study provides a new potential target and a candidate drug for treating breast cancer.
Keywords: breast cancer; scribble planar cell polarity protein (SCRIB); HnRNP A1; alternative splicing; invasion; ASO-SCRIB

Article Options

Download Citation

Cited times in Scopus

Share